Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing, Membrane

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Comparison, Mutagenesis, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet:

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Plasmid Preparation, Membrane, Mutagenesis, Transgenic Assay, Expressing

Journal: bioRxiv

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.1101/2022.07.17.500324

Figure Lengend Snippet: A ) The endocytic recycling pathway during sheath initiation and loss (Adapted from “Endocytic Pathway with Macropinocytosis and Phagocytosis”, by BioRender.com (2022). Retrieved from https://app.biorender.com/biorender-templates/t-5ea05f35722d6800ab456324-endocytic-pathway-with-macropinocytosis-and-phagocytosis ). B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C, myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). C ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5c n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11a n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae, Rab7a n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). The dashed lines represent average values for all data points.

Article Snippet: Plasmids encoding the RAB5C, RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C = 80518, RAB7A = 80522, and RAB11A = 80529, ( )) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation (D63G and Q166R respectively) relative to the NCBI protein sequences (RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing

Journal: bioRxiv

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.1101/2022.07.17.500324

Figure Lengend Snippet: A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4dpf labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP, myrf:tagRFP-RAB5C, myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A, myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A, myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in . (Scale bar = 5 μm). B )Sheath number per cell. C ) Average sheath length per cell. D )Total sheath length per cell (myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Global significance was determined using a Kruskal-Wallis test for B-D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. Before running the tests, we decided to compare everything with the control group and to also compare each wild-type and associated mutant with each other. The different Rab groups were not compared with each other.

Article Snippet: Plasmids encoding the RAB5C, RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C = 80518, RAB7A = 80522, and RAB11A = 80529, ( )) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation (D63G and Q166R respectively) relative to the NCBI protein sequences (RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Comparison, Mutagenesis

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing, Membrane

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Comparison, Mutagenesis, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Lateral images from the ventral spinal cord of living larvae labeled with sox10 : eGFP-CAAX (in green) and one of the following: myrf:tagRFP , myrf:tagRFP - RAB5C , myrf:tagRFP-rab5C S36N (all in magenta); and time-lapsed for 15 hours from 2.5-3dpf. The first panel is an image taken immediately before starting the time-lapse experiment. The subsequent panels are the same cells at the peak of sheath accumulation, at 3dpf, and at 4dpf. The images and data for the control are the same as for the ventral group in . (Scale bar = 5 μm). ( B ) Total ensheathment attempts per cell. ( C ) Peak sheath number per cell. ( D ) Sheath number at 3dpf per cell. ( E ) Final sheath number per cell at 4dpf. ( F ) Net sheaths lost from the peak to 4dpf. ( G ) Percent of sheaths stabilized during the accumulation phase (peak sheath number/total ensheathment attempts). (H) Percent of sheaths stabilized during the stabilization phase (final sheath number/peak sheath number). ( I ) Percent of total sheaths stabilized across both the accumulation and stabilization phases (final sheath number/total ensheathment attempts). ( J ) Simple linear regression comparing the total number of ensheathment attempts to the final sheath number at 4dpf for each cell. (control n=18 cells/18 larvae, wild-type Rab5 n=18 cells/18 larvae, Rab5DN n=18 cells/17 larvae). The dashed lines in each plot represent average values with all data points shown. The error bars are standard deviation. Significance was determined using global Kruskal-Wallis tests. These p-values are shown for B-D and G since they were not significant. Post hoc multiple comparisons tests were not performed for these analyses. Post hoc Dunn’s multiple comparisons tests were done for E, F, H, and I and the individual p-values are shown. ( J’ ) The slopes of the Rab5WT and Rab5DN regression lines from J were compared to the control in Graphpad by (two-tailed) testing the null hypothesis that the slopes are identical (the lines are parallel). P-values are shown in the table. (See associated source data and supplementary video files). Figure 9—source data 1. Excel spreadsheet with the summary data for the Rab5 dominant-negative mutant oligodendrocyte ensheathment dynamics experiment.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Two Tailed Test, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet:

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Plasmid Preparation, Membrane, Mutagenesis, Transgenic Assay, Expressing

Journal: Biochimica et biophysica acta

Article Title: Acetylation of lysine 109 modulates pregnane X receptor DNA binding and transcriptional activity

doi: 10.1016/j.bbagrm.2016.01.006

Figure Lengend Snippet: p300 and SIRT1 modulate PXR's transcriptional activity. 293T cells were co-transfected with pSG5-PXR, CYP3A4-Luc (A, C, E, F) or MDR1-Luc reporter (B, D), and pCMV-β-galactosidase control plasmids. 24 h after transfection, cells were treated with DMSO, Rif, or SR12813 as indicated for an additional 24 h. (A, B) Cells were co-transfected with pCDNA3.1. empty vector control, pCDNA3.1-p300, or pCDNA3.1-p300 ΔHAT mutant as well. (C, D) Cells were co-transfected with pCDNA3.1. empty vector control, pECE-SIRT1, or pECE-SIRT1 H363Y. (E) Transfected cells were treated with increasing concentrations of TSA (E), or NAM (F) at the same time with DMSO or RIF as indicated. Cells were then lysed and luciferase and β-galactosidase activities were measured. Luciferase values were normalized to β-galactosidase activities. The data represents the mean and SEM of at least 3 independent experiments performed in triplicate. ****p < 0.05, n.s., not significant 2-way ANOVA. Rif = rifampicin, TSA = Trichostatin A, NAM = nicotinamide.

Article Snippet: The MDR1-Luc reporter construct containing ~8.3 kb of the natural MDR1 promoter (−8055/+261) was a kind gift from Dr. Oliver Burk and described previously [ 44 ]. pCDNA3.1-p300 (Addgene #23252) and pCDNA3.1-p300ΔHAT (Addgene #23254) were gifts from Warner Greene [ 45 ]. pECE-FLAG- SIRT1 (Addgene #1791) and pECE-FLAG-SIRT1 H363Y (Addgene #1792) plasmids were gifts from Michael Greenberg [ 46 ].

Techniques: Activity Assay, Transfection, Control, Plasmid Preparation, Mutagenesis, Luciferase

Journal: Biochimica et biophysica acta

Article Title: Acetylation of lysine 109 modulates pregnane X receptor DNA binding and transcriptional activity

doi: 10.1016/j.bbagrm.2016.01.006

Figure Lengend Snippet: Lysine 109 acetylation down-regulates PXR's transcriptional activity. (A) Structures of lysine, acetyl-lysine, and corresponding mimicking residues arginine and glutamine, respectively. Mutational mimics are based on charge of the amino acid R-group. (B) Western blot showing equal expression levels of PXR WT, K109R, and K109Q in transfected 293T cells. (C) 293T cells were co-transfected with the MDR1-Luc reporter, and pCMV-β-galactosidase control plasmid along with pSG5- PXR WT, K109R, or K109Q. Cells were treated with DMSO or various concentrations of SR12813 24 h after transfection for an additional 24 h and luciferase and β-galactosidase activities were measured. Luciferase values were normalized to β-galactosidase activities. The data represents the mean and SEM of at least 3 independent experiments performed in triplicate. (D) The experiment described in (C) was repeated using the p3A4-Luc reporter instead. Cells were treated with RIF or SR12813 as indicated. (E) HepG2 cells were transfected with the plasmids as indicated and treated with DMSO or 10 µM RIF for 24 h. CYP3A4 mRNA levels were measured by qRT-PCR and corresponding protein levels measured by immunoblot. Data were processed by delta–delta method. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n.s., not significant, Student's t-test. 2-way ANOVA was used for data analysis presented in (E).

Article Snippet: The MDR1-Luc reporter construct containing ~8.3 kb of the natural MDR1 promoter (−8055/+261) was a kind gift from Dr. Oliver Burk and described previously [ 44 ]. pCDNA3.1-p300 (Addgene #23252) and pCDNA3.1-p300ΔHAT (Addgene #23254) were gifts from Warner Greene [ 45 ]. pECE-FLAG- SIRT1 (Addgene #1791) and pECE-FLAG-SIRT1 H363Y (Addgene #1792) plasmids were gifts from Michael Greenberg [ 46 ].

Techniques: Activity Assay, Western Blot, Expressing, Transfection, Control, Plasmid Preparation, Luciferase, Quantitative RT-PCR

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: a Balb/c mice were vaccinated with the C20 vaccine at days 0, 21, and 42 and challenged with CT26 cells on day 62. One week after the last immunization (day 49), mice were bled retro-orbitally to monitor T cell immune response against CT26-neoepitopes by intracellular staining. Panel describes CD8 and CD4 neoantigen-specific effector and central memory T cell responses measured by FC using the gating strategy depicted in Supplementary Fig. . The stimulation pool included the 15 peptides listed in Table . b The panel depicts CT26 tumor growth overtime of one out of two experiments performed. Five animals per group were utilized. Each symbol represents an individual sample with the error bars representing the s.e.m. Significance was determined using Mann–Whitney test (* p < 0,05).

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: Staining, MANN-WHITNEY

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: Immunogenic neoantigens expressed by C20 vaccine.

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: Immunopeptidomics, Enzyme-linked Immunospot

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: a Balb/c mice were inoculated s.c. with CT26 cells and treated with C20 and ICI starting from day 2 as depicted in the experimental scheme. Tumor volume and survival curve. b , c Balb/c mice were inoculated s.c. with CT26 cells and treated with ICI and NCV according to the experimental scheme. b Tumor (50–100 mm 3 ) bearing mice were randomized at day 6 and treated with αCTLA-4 and vaccinated with C20 the day after. The treatment was repeated weekly as described in the scheme. b Tumor volume measurements and survival curve. This experiment was conducted only once ( C ) CT26 tumor growth in CD4 or CD8 depleted mice treated as in panel ( b ). This experiment was repeated twice with similar results. Six animals per group were utilized with the error bars representing the s.e.m. Significance was determined using Mann–Whitney and Log-rank (Mantel–Cox) test ** p < 0.01 *** p < 0.001.

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: MANN-WHITNEY

Journal: Developmental Cell

Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

doi: 10.1016/j.devcel.2021.01.010

Figure Lengend Snippet: Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

Techniques: Expressing, Labeling

Journal: Developmental Cell

Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

doi: 10.1016/j.devcel.2021.01.010

Figure Lengend Snippet:

Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

Techniques: Recombinant, Derivative Assay, shRNA, Sequencing, Mutagenesis, Plasmid Preparation, Software